Python Courses, Training, and Tutorials

I am struggeling in writing the output of my code to a txt file while keeping the format. Here is t… Read more Python - Write Matrix To Txt File, Keep Formatting

Below is my code for a DNA string neighboring question: chars = 'ACGT' def neighbors(patt… Read more How To Print Out Elements Of Tuple One Per Line

What is the simplest way to display the Python ystockquote (http://goldb.org/ystockquote.html) modu… Read more Display Python Output In Html

I have a file, called list.txt, which is a list of names of files: input1.txt input2.txt input3.txt… Read more Python: Script To Make Multiple Bash Scripts

I have the following list of dictionaries: [{'Sequence': 'TGACCCTGCTTGGCGATCCCGGCGTTTC&… Read more Python: List Of Dictionaries: How To - Nice Printout Using Sys.stdout

I'm trying to write a python script that will allow me to take the output from a command and to… Read more Redirect An Output Command To A Variable Or File?

I have this code to calculate minimum number of coins from a sum with given list of denomiations. f… Read more Unexpected Behaviour In This Program In Python

I am able to get the output/predictions of all layers as suggested in Keras Docs: how-can-i-obtain-… Read more Keras/tensorflow: Get Predictions Or Output Of All Layers Efficiently